BINF 5445/4445 HW 11 due Wednesday 11/9/11 by 1:00 p.m.

 

1) Review: get a *new* plagiarism certificate from https://www.indiana.edu/~istd/test.html. For background information, exercises, etc., see https://www.indiana.edu/~istd. If you have any questions or confusions, keep them in mind and we will discuss in class.

2) Check out the PROSITE Web site. Explain what you found.

3) Check out the PROSITE Web site some more. Explain what you found this time.

4) Consider the DNA strings below. There are two strings shown because DNA has two strands. The two strands below are complementary. Explain why you would agree (or disagree) that they are complementary. Then, of the 6 reading frames, which is the correct one if this DNA contains a gene consisting of a single exon beginning near the beginning of the strand and ending near the end? Explain why, and if you need a hint, drop me an email.

 

ACCGCGTTCTACGTACCTACCGGACCAATGCTACGTCACA

CTCTACTAGCTAGTCGGCCAATGCTATCCTGAGACGTCAC

TTACGATGCTAGATTTCTAGCCGATATGATTCGAGCACAA

TATGCCTAGCAATCGCTGACACCGATGCGAGAACAACTTA

ATGTTGAGAGAAAATAGCGAACTTGCTATAAGCTGATAGC

CATATCACACGCGACTTAGCTGTACCGATTATGCTCAACG

ATGATCCGGTACCGATGCAGTTCGACGATTTACACACTAC

AAAGGCTACCGTAGACTCTTACAAACTGATTCGCGCC        

 

TGGCGCAAGATGCATGGATGGCCTGGTTACGATGCAGTGT

GAGATGATCGATCAGCCGGTTACGATAGGACTCTGCAGTG

AATGCTACGATCTAAAGATCGGCTATACTAAGCTCGTGTT

ATACGGATCGTTAGCGACTGTGGCTACGCTCTTGTTGAAT

TACAACTCTCTTTTATCGCTTGAACGATATTCGACTATCG

GTATAGTGTGCGCTGAATCGACATGGCTAATACGAGTTGC

TACTAGGCCATGGCTACGTCAAGCTGCTAAATGTGTGATG

TTTCCGATGGCATCTGAGAATGTTTGACTAAGCGCGG

5) Grad students: continue with the project. This could be the topic of a paper, poster, or presentation outside of class, although that is not a requirement for this class.

a.         Make significant progress, either starting a new goal, finishing your current goal if it is not finished yet, or getting close to finishing it if it is still near the beginning.

b.         Report on it in a slide or two during class on Wednesday.

c.         Update your term paper with everything on the project from the beginning of the semester.

 

Don’t do:       Read the textbook (Zvelebil and Baum) pages 90 through 95. Also check the Web as needed.

Don’t do:       List 4 concepts that were not discussed in class on 10/18/10 related to multiple sequence alignment, and which you can figure out well enough to explain.

Don’t do:       Explain them.

Don’t do:       List 3 concepts in these pages that were discussed in class, but the coverage is at least somewhat different.

Don’t do:       Explain the new insights about these concepts you have obtained by supplementing the lecture with this reading.

Don’t do:      Prepare one slide on some interesting item you found regarding the topic: annotation.